Transcript: Human XM_017016042.1

PREDICTED: Homo sapiens protein tyrosine phosphatase non-receptor type 20 (PTPN20), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPN20 (26095)
Length:
3152
CDS:
209..1447

Additional Resources:

NCBI RefSeq record:
XM_017016042.1
NBCI Gene record:
PTPN20 (26095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016042.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078566 TCTTCGGAATTTCCCACATAA pLKO.1 379 CDS 100% 13.200 18.480 N PTPN20 n/a
2 TRCN0000078567 GTAAACGATTATGAGGGAAAT pLKO.1 242 CDS 100% 10.800 15.120 N PTPN20 n/a
3 TRCN0000078565 GCGTATGATATCATGCAGGAA pLKO.1 674 CDS 100% 2.640 3.696 N PTPN20 n/a
4 TRCN0000029897 CGAGATATTCTTCCATATGAT pLKO.1 776 CDS 100% 0.000 0.000 N Ptpn20 n/a
5 TRCN0000255616 GACTTTGCCTCGTACAATTAA pLKO_005 2672 3UTR 100% 15.000 12.000 N PTPN20 n/a
6 TRCN0000360289 CGATTGCAGCTTGGCTATTTG pLKO_005 1831 3UTR 100% 13.200 10.560 N PTPN20 n/a
7 TRCN0000255617 GGCTCAGATTCGGCCATTAAT pLKO_005 589 CDS 100% 15.000 10.500 N PTPN20 n/a
8 TRCN0000255614 TGATATCATGCAGGAATTTAT pLKO_005 679 CDS 100% 15.000 10.500 N PTPN20 n/a
9 TRCN0000255615 CAGAGCCTGTAAACGATTATG pLKO_005 234 CDS 100% 13.200 9.240 N PTPN20 n/a
10 TRCN0000078563 CCACCCTAACACTTAACATAT pLKO.1 2306 3UTR 100% 13.200 9.240 N PTPN20 n/a
11 TRCN0000078564 CTTCGGAATTTCCCACATAAT pLKO.1 380 CDS 100% 13.200 9.240 N PTPN20 n/a
12 TRCN0000360290 TTCGGCCATTAATATTCAATT pLKO_005 597 CDS 100% 13.200 9.240 N PTPN20 n/a
13 TRCN0000360288 AGCTCCCTGAAGGGCAATATC pLKO_005 1714 3UTR 100% 13.200 7.920 N PTPN20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016042.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11809 pDONR223 100% 37.8% 36.8% None (many diffs) n/a
2 ccsbBroad304_11809 pLX_304 0% 37.8% 36.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478274 CACCATAGGAAAGCATTCACTAGC pLX_317 63.1% 37.8% 36.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV