Transcript: Human XM_017016107.1

PREDICTED: Homo sapiens mohawk homeobox (MKX), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MKX (283078)
Length:
1240
CDS:
131..1018

Additional Resources:

NCBI RefSeq record:
XM_017016107.1
NBCI Gene record:
MKX (283078)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419234 CGCTAGTGCAGGTGTCAAATT pLKO_005 468 CDS 100% 13.200 18.480 N Mkx n/a
2 TRCN0000015642 CCTCAAGCAGTGGCTTTACAA pLKO.1 382 CDS 100% 5.625 7.875 N MKX n/a
3 TRCN0000422067 GTTCACCATCCTGTGATTAAA pLKO_005 686 CDS 100% 15.000 10.500 N MKX n/a
4 TRCN0000424915 TAATGCAAGACGTCGGCTTAA pLKO_005 496 CDS 100% 10.800 7.560 N MKX n/a
5 TRCN0000015638 GCCAGATTTAAGCTGGGCTTT pLKO.1 532 CDS 100% 4.050 2.835 N MKX n/a
6 TRCN0000015641 CCAATGAATTTGAGGAAGAAT pLKO.1 897 CDS 100% 5.625 3.375 N MKX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09934 pDONR223 100% 81.9% 80.4% None (many diffs) n/a
2 ccsbBroad304_09934 pLX_304 0% 81.9% 80.4% V5 (many diffs) n/a
3 TRCN0000473396 TTTGTCACGATCCCTGTGCTCGGG pLX_317 36% 81.9% 80.4% V5 (many diffs) n/a
Download CSV