Transcript: Human XM_017016204.1

PREDICTED: Homo sapiens inositol polyphosphate-5-phosphatase A (INPP5A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INPP5A (3632)
Length:
2662
CDS:
147..1211

Additional Resources:

NCBI RefSeq record:
XM_017016204.1
NBCI Gene record:
INPP5A (3632)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016204.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050513 CGTCTGTCTATGTGACATTAA pLKO.1 1399 3UTR 100% 13.200 10.560 N INPP5A n/a
2 TRCN0000050515 CGAGTGCAAATGGTCAAGAAA pLKO.1 443 CDS 100% 5.625 4.500 N INPP5A n/a
3 TRCN0000382220 GAAGTGGTGAAGCTCATATTT pLKO_005 756 CDS 100% 15.000 10.500 N INPP5A n/a
4 TRCN0000050516 GTGGACAAGTTCGTCAAAGAA pLKO.1 74 5UTR 100% 5.625 3.938 N INPP5A n/a
5 TRCN0000081201 CCAGTTTGACTTTAAAGCTAA pLKO.1 326 CDS 100% 4.950 3.465 N Inpp5a n/a
6 TRCN0000050514 CGGAAGGTTATGCTCCAGTTA pLKO.1 795 CDS 100% 4.950 3.465 N INPP5A n/a
7 TRCN0000050517 GCGATTCGAGAAGGTTTCCTA pLKO.1 632 CDS 100% 3.000 2.100 N INPP5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016204.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00875 pDONR223 100% 82% 74.5% None (many diffs) n/a
2 ccsbBroad304_00875 pLX_304 0% 82% 74.5% V5 (many diffs) n/a
3 TRCN0000468169 ATACCACTGAGCTATACTGATATG pLX_317 35.2% 82% 74.5% V5 (many diffs) n/a
Download CSV