Transcript: Human XM_017016279.1

PREDICTED: Homo sapiens ornithine aminotransferase (OAT), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OAT (4942)
Length:
3887
CDS:
2529..3248

Additional Resources:

NCBI RefSeq record:
XM_017016279.1
NBCI Gene record:
OAT (4942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034850 GCTTCGAGAGTCCATTGAAAT pLKO.1 3200 CDS 100% 13.200 18.480 N OAT n/a
2 TRCN0000034853 CGACTTCGAGATAATGGACTT pLKO.1 3114 CDS 100% 4.050 5.670 N OAT n/a
3 TRCN0000034849 CCCAACCAGTTACGATGGTTT pLKO.1 2498 5UTR 100% 0.495 0.693 N OAT n/a
4 TRCN0000034852 GCTACATCTGTTGCAACTAAA pLKO.1 148 5UTR 100% 13.200 10.560 N OAT n/a
5 TRCN0000034851 GTTCTCTTTATTGCTGATGAA pLKO.1 2700 CDS 100% 4.950 3.465 N OAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15514 pDONR223 0% 54.3% 54.4% None 0_1ins600;534C>T n/a
2 ccsbBroad304_15514 pLX_304 0% 54.3% 54.4% V5 0_1ins600;534C>T n/a
3 TRCN0000472176 AGTCCCTCATAACCATTTATAACC pLX_317 35.3% 54.3% 54.4% V5 0_1ins600;534C>T n/a
4 ccsbBroadEn_06665 pDONR223 100% 54.3% 54.4% None 0_1ins600;711G>A n/a
5 ccsbBroad304_06665 pLX_304 0% 54.3% 54.4% V5 0_1ins600;711G>A n/a
6 TRCN0000473531 GATCACCGAGTCTTGAAACCCTTA pLX_317 34.8% 54.3% 54.4% V5 0_1ins600;711G>A n/a
Download CSV