Transcript: Human XM_017016308.2

PREDICTED: Homo sapiens calcium homeostasis modulator family member 2 (CALHM2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CALHM2 (51063)
Length:
1937
CDS:
610..1200

Additional Resources:

NCBI RefSeq record:
XM_017016308.2
NBCI Gene record:
CALHM2 (51063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164088 CAAGCATTACTGCTCACCACT pLKO.1 1211 3UTR 100% 2.640 3.696 N CALHM2 n/a
2 TRCN0000163871 CTACTTGTACCGTGAGAACCA pLKO.1 1448 3UTR 100% 2.640 3.696 N CALHM2 n/a
3 TRCN0000429904 CTCACCAGTGGGCTCCTTTAT pLKO_005 1772 3UTR 100% 13.200 9.240 N CALHM2 n/a
4 TRCN0000162181 CAAGAGCAAGGATGTGATGAT pLKO.1 657 CDS 100% 4.950 3.465 N CALHM2 n/a
5 TRCN0000436604 CTGTCACCTGGTCTGTCATCT pLKO_005 950 CDS 100% 4.950 3.465 N CALHM2 n/a
6 TRCN0000162359 CTTCAAGAGCAAGGATGTGAT pLKO.1 654 CDS 100% 4.950 3.465 N CALHM2 n/a
7 TRCN0000161042 GCTCTTCATCATTGGCATCAT pLKO.1 810 CDS 100% 4.950 3.465 N CALHM2 n/a
8 TRCN0000422809 GCTTGCTCACATCCATATCAG pLKO_005 1628 3UTR 100% 4.950 3.465 N CALHM2 n/a
9 TRCN0000162509 CTCAACAAGGATGATGAGGAA pLKO.1 1362 3UTR 100% 2.640 1.848 N CALHM2 n/a
10 TRCN0000163232 GCTCAACAAGGATGATGAGGA pLKO.1 1361 3UTR 100% 2.640 1.848 N CALHM2 n/a
11 TRCN0000173987 GTCTGTGCTCTCAGTGAGTTT pLKO.1 994 CDS 100% 4.950 3.465 N Calhm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08207 pDONR223 100% 60.5% 57.5% None 13A>N;539_540insCAGGTATGAGTCC;588_589ins368 n/a
2 ccsbBroad304_08207 pLX_304 0% 60.5% 57.5% V5 13A>N;539_540insCAGGTATGAGTCC;588_589ins368 n/a
3 TRCN0000465862 AAACGTCGCGTCCATGCTGTTGCC pLX_317 32.9% 60.5% 57.5% V5 13A>N;539_540insCAGGTATGAGTCC;588_589ins368 n/a
Download CSV