Transcript: Human XM_017016345.2

PREDICTED: Homo sapiens exocyst complex component 6 (EXOC6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXOC6 (54536)
Length:
3710
CDS:
176..2575

Additional Resources:

NCBI RefSeq record:
XM_017016345.2
NBCI Gene record:
EXOC6 (54536)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430500 CCAAACTCCGTGAGGATATTA pLKO_005 717 CDS 100% 15.000 21.000 N EXOC6 n/a
2 TRCN0000432288 TTAGATGCTTGTATCCGTAAT pLKO_005 311 CDS 100% 10.800 15.120 N EXOC6 n/a
3 TRCN0000062472 CCCAGTCGAATATGCATGAAA pLKO.1 1119 CDS 100% 5.625 7.875 N EXOC6 n/a
4 TRCN0000062469 GCTCAACAGAAATAGACGATA pLKO.1 1686 CDS 100% 4.950 6.930 N EXOC6 n/a
5 TRCN0000062468 GCAGTTTAACTTAGATGTCAT pLKO.1 2224 CDS 100% 4.950 3.960 N EXOC6 n/a
6 TRCN0000062471 CCCTTTCAAGATCCAGACCTT pLKO.1 1550 CDS 100% 2.640 2.112 N EXOC6 n/a
7 TRCN0000062470 GCAATGAAACAGGCACAGCAT pLKO.1 812 CDS 100% 2.640 2.112 N EXOC6 n/a
8 TRCN0000374981 GCTGTTTACTGAACCTTATTA pLKO_005 1752 CDS 100% 15.000 10.500 N Exoc6 n/a
9 TRCN0000422237 TGGTTATTTAATGGACCTTAT pLKO_005 2050 CDS 100% 10.800 7.560 N EXOC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08392 pDONR223 100% 97% 97% None (many diffs) n/a
2 ccsbBroad304_08392 pLX_304 0% 97% 97% V5 (many diffs) n/a
3 TRCN0000471944 ACTAAGCTACCCAAAATGATGTTT pLX_317 17.3% 97% 97% V5 (many diffs) n/a
Download CSV