Transcript: Human XM_017016349.1

PREDICTED: Homo sapiens shieldin complex subunit 2 (SHLD2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHLD2 (54537)
Length:
4057
CDS:
327..3272

Additional Resources:

NCBI RefSeq record:
XM_017016349.1
NBCI Gene record:
SHLD2 (54537)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062795 CCAGCGTTAATGACTGCCATT pLKO.1 2958 CDS 100% 4.050 2.430 N SHLD2 n/a
2 TRCN0000286878 CCAGCGTTAATGACTGCCATT pLKO_005 2958 CDS 100% 4.050 2.430 N SHLD2 n/a
3 TRCN0000294286 CTAAACATCAGCCAGATATAT pLKO_005 868 CDS 100% 15.000 7.500 Y SHLD2 n/a
4 TRCN0000307296 ATACTGTGTTCCCAACTAAAT pLKO_005 1500 CDS 100% 13.200 6.600 Y SHLD2 n/a
5 TRCN0000062793 GCCCATTTGTTCACTGTATTT pLKO.1 3546 3UTR 100% 13.200 6.600 Y SHLD2 n/a
6 TRCN0000294287 TTTCGCTTATCCCTACCTAAA pLKO_005 3646 3UTR 100% 10.800 5.400 Y SHLD2 n/a
7 TRCN0000062797 CCTGTAAATAAAGGGAATGTA pLKO.1 1203 CDS 100% 5.625 2.813 Y SHLD2 n/a
8 TRCN0000062794 CGGACCAAATTCTGGCTCTAA pLKO.1 1796 CDS 100% 4.950 2.475 Y SHLD2 n/a
9 TRCN0000062796 CCCAGAAGATTCACTCCTCTA pLKO.1 724 CDS 100% 4.050 2.025 Y SHLD2 n/a
10 TRCN0000286879 CCCAGAAGATTCACTCCTCTA pLKO_005 724 CDS 100% 4.050 2.025 Y SHLD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016349.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03431 pDONR223 100% 85.1% 85% None 1_87del;1613_1756del;2193_2399del n/a
2 ccsbBroad304_03431 pLX_304 0% 85.1% 85% V5 1_87del;1613_1756del;2193_2399del n/a
Download CSV