Transcript: Human XM_017016452.2

PREDICTED: Homo sapiens G protein-coupled receptor 158 (GPR158), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPR158 (57512)
Length:
5526
CDS:
484..2571

Additional Resources:

NCBI RefSeq record:
XM_017016452.2
NBCI Gene record:
GPR158 (57512)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062923 CGGATTGGATATGAGACAGAA pLKO.1 2606 3UTR 100% 4.950 6.930 N GPR158 n/a
2 TRCN0000062926 GCCAAGCACATTTCGCTGTAT pLKO.1 348 5UTR 100% 4.950 6.930 N GPR158 n/a
3 TRCN0000360101 ACCTGAACAGCAGTATCAATT pLKO_005 1007 CDS 100% 13.200 9.240 N GPR158 n/a
4 TRCN0000360065 CCAAGCACATTTCGCTGTATT pLKO_005 349 5UTR 100% 13.200 9.240 N GPR158 n/a
5 TRCN0000062924 GCCTCAGAAATCTGGGATTAT pLKO.1 1830 CDS 100% 13.200 9.240 N GPR158 n/a
6 TRCN0000360064 TTGATAGCACTGCTAACTTAA pLKO_005 3009 3UTR 100% 13.200 9.240 N GPR158 n/a
7 TRCN0000062927 CGCATAGATAAGGCTGAAGTA pLKO.1 2116 CDS 100% 4.950 3.465 N GPR158 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489442 GACCACGCCGGGTCAAAAACTGCA pLX_317 10% 43.3% 57.1% V5 (many diffs) n/a
2 TRCN0000488674 ACGCCATCCGCCAAGCCGAGTGTG pLX_317 7% 43.3% 57.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV