Transcript: Human XM_017016458.1

PREDICTED: Homo sapiens STAM binding protein like 1 (STAMBPL1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAMBPL1 (57559)
Length:
1619
CDS:
349..1341

Additional Resources:

NCBI RefSeq record:
XM_017016458.1
NBCI Gene record:
STAMBPL1 (57559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426861 TGAATGTAAGCACCGTCAACA pLKO_005 1349 3UTR 100% 4.950 6.930 N STAMBPL1 n/a
2 TRCN0000073964 GCTTCCTAACCATCGAGATTA pLKO.1 294 5UTR 100% 13.200 10.560 N STAMBPL1 n/a
3 TRCN0000426623 ACGTAGAATACCAAGAATATT pLKO_005 419 CDS 100% 15.000 10.500 N STAMBPL1 n/a
4 TRCN0000417516 AGAGTTAGCCCGAGGTCAAAT pLKO_005 591 CDS 100% 13.200 9.240 N STAMBPL1 n/a
5 TRCN0000434316 GGACATGTGGTTGCCGGATTT pLKO_005 1386 3UTR 100% 10.800 7.560 N STAMBPL1 n/a
6 TRCN0000420358 TGTTGGATCTGAGGTGATATG pLKO_005 1325 CDS 100% 10.800 7.560 N STAMBPL1 n/a
7 TRCN0000073965 GCTTGAGGTTTCTGCTTGTAA pLKO.1 1218 CDS 100% 5.625 3.938 N STAMBPL1 n/a
8 TRCN0000073967 CCAGAACAATTCCTTGCTGAA pLKO.1 681 CDS 100% 4.050 2.835 N STAMBPL1 n/a
9 TRCN0000073963 GCTGCTACTCTAAGTGCTGTT pLKO.1 784 CDS 100% 4.050 2.835 N STAMBPL1 n/a
10 TRCN0000428322 GATGTTTCCAGAAATGACTGA pLKO_005 1413 3UTR 100% 2.640 1.848 N STAMBPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12364 pDONR223 100% 78.3% 78.3% None 0_1ins273;432G>A n/a
2 ccsbBroad304_12364 pLX_304 0% 78.3% 78.3% V5 0_1ins273;432G>A n/a
3 TRCN0000480021 CTGAATGGTCAGGTTACATATGTT pLX_317 36.2% 78.3% 78.3% V5 0_1ins273;432G>A n/a
Download CSV