Transcript: Human XM_017016651.1

PREDICTED: Homo sapiens coiled-coil domain containing 7 (CCDC7), transcript variant X40, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC7 (79741)
Length:
2915
CDS:
310..2781

Additional Resources:

NCBI RefSeq record:
XM_017016651.1
NBCI Gene record:
CCDC7 (79741)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128807 CCATTCCATCGAGTAAGACAA pLKO.1 512 CDS 100% 4.950 6.930 N CCDC7 n/a
2 TRCN0000130260 CCGTGAAAGTCATGTTGTCTA pLKO.1 959 CDS 100% 4.950 6.930 N CCDC7 n/a
3 TRCN0000128246 GCAGAAATAGTAAGGCTTGTA pLKO.1 889 CDS 100% 4.950 6.930 N CCDC7 n/a
4 TRCN0000130295 CGGCAAATGTTCCAGCATTAA pLKO.1 350 CDS 100% 13.200 10.560 N CCDC7 n/a
5 TRCN0000130461 GAAGAACTGAAGAATCGCCTT pLKO.1 919 CDS 100% 2.160 1.728 N CCDC7 n/a
6 TRCN0000130087 CAAAGCGGAAGACTGATTGAA pLKO.1 1738 CDS 100% 5.625 3.938 N CCDC7 n/a
7 TRCN0000129232 CTATGGACATTGCGATCAGAA pLKO.1 612 CDS 100% 4.950 3.465 N CCDC7 n/a
8 TRCN0000129043 GACAACAATGCAAGTGGGTAA pLKO.1 1584 CDS 100% 4.050 2.835 N CCDC7 n/a
9 TRCN0000128247 GCTCATTCAATGACTAATCGA pLKO.1 1111 CDS 100% 3.000 2.100 N CCDC7 n/a
10 TRCN0000129676 CAGAAGATGAAATGATCGGAA pLKO.1 545 CDS 100% 2.640 1.848 N CCDC7 n/a
11 TRCN0000130183 CAGGTCAATCAGATGGAAGAA pLKO.1 799 CDS 100% 4.950 2.970 N CCDC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05247 pDONR223 100% 58.9% 58.8% None 1455C>A;1456_1457insG;1458_2469del n/a
2 ccsbBroad304_05247 pLX_304 0% 58.9% 58.8% V5 1455C>A;1456_1457insG;1458_2469del n/a
3 TRCN0000474906 ACCAACGAGAACCAAGGACGGAGG pLX_317 31.4% 58.9% 58.8% V5 1455C>A;1456_1457insG;1458_2469del n/a
Download CSV