Transcript: Human XM_017016661.1

PREDICTED: Homo sapiens major facilitator superfamily domain containing 13A (MFSD13A), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MFSD13A (79847)
Length:
1477
CDS:
424..1338

Additional Resources:

NCBI RefSeq record:
XM_017016661.1
NBCI Gene record:
MFSD13A (79847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016661.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243138 ATGTCTTCCTGCTCTACTATG pLKO_005 515 CDS 100% 10.800 7.560 N MFSD13A n/a
2 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1265 CDS 100% 4.950 2.475 Y ERAP2 n/a
3 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1266 CDS 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016661.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08968 pDONR223 100% 57.2% 53.9% None (many diffs) n/a
2 ccsbBroad304_08968 pLX_304 0% 57.2% 53.9% V5 (many diffs) n/a
3 TRCN0000475486 ACCACTAATACATCGGAACCCTTT pLX_317 19.1% 57.2% 53.9% V5 (many diffs) n/a
Download CSV