Transcript: Human XM_017016860.2

PREDICTED: Homo sapiens pre-mRNA processing factor 18 (PRPF18), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRPF18 (8559)
Length:
1683
CDS:
277..1164

Additional Resources:

NCBI RefSeq record:
XM_017016860.2
NBCI Gene record:
PRPF18 (8559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010512 GACGAAACTCAGCGGAAATAT pLKO.1 1057 CDS 100% 15.000 12.000 N PRPF18 n/a
2 TRCN0000314724 GACGAAACTCAGCGGAAATAT pLKO_005 1057 CDS 100% 15.000 12.000 N PRPF18 n/a
3 TRCN0000000016 GATCTGTGTATGGTGTGTTAA pLKO.1 1165 CDS 100% 13.200 9.240 N PRPF18 n/a
4 TRCN0000314726 GATCTGTGTATGGTGTGTTAA pLKO_005 1165 CDS 100% 13.200 9.240 N PRPF18 n/a
5 TRCN0000000019 GAATACGTGAAGGCAAATGAT pLKO.1 916 CDS 100% 5.625 3.938 N PRPF18 n/a
6 TRCN0000000018 GACTATTTGGAGAGACTGATT pLKO.1 563 CDS 100% 4.950 3.465 N PRPF18 n/a
7 TRCN0000000017 GAGGAGAACCAATCAGACTAT pLKO.1 548 CDS 100% 4.950 3.465 N PRPF18 n/a
8 TRCN0000314723 GAGGAGAACCAATCAGACTAT pLKO_005 548 CDS 100% 4.950 3.465 N PRPF18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07263 pDONR223 100% 86% 85.9% None 8T>C;549A>G;578_579ins141 n/a
2 ccsbBroad304_07263 pLX_304 0% 86% 85.9% V5 8T>C;549A>G;578_579ins141 n/a
3 TRCN0000480692 TTCAGCATCACCTTTAACGAACCA pLX_317 42.2% 86% 85.9% V5 8T>C;549A>G;578_579ins141 n/a
Download CSV