Transcript: Human XM_017016875.2

PREDICTED: Homo sapiens polycystin 2 like 1, transient receptor potential cation channel (PKD2L1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PKD2L1 (9033)
Length:
3614
CDS:
744..2876

Additional Resources:

NCBI RefSeq record:
XM_017016875.2
NBCI Gene record:
PKD2L1 (9033)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016875.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056106 CCACTACTGGACAGTTTGTAT pLKO.1 942 CDS 100% 5.625 7.875 N PKD2L1 n/a
2 TRCN0000428650 ATTGATGCTGTAGGCTCAAAG pLKO_005 2634 CDS 100% 10.800 8.640 N PKD2L1 n/a
3 TRCN0000056105 GCCATCATCAATGACACATAT pLKO.1 2124 CDS 100% 13.200 9.240 N PKD2L1 n/a
4 TRCN0000415612 ACTACAATGCTATCGACAATG pLKO_005 2026 CDS 100% 10.800 7.560 N PKD2L1 n/a
5 TRCN0000418768 CCCACTCCTTCATCTACTATG pLKO_005 1003 CDS 100% 10.800 7.560 N PKD2L1 n/a
6 TRCN0000056103 GCCGTCATGTTCTTCATTGTT pLKO.1 1893 CDS 100% 5.625 3.938 N PKD2L1 n/a
7 TRCN0000056104 GCTGGGTTTCAGGAGAAGAAT pLKO.1 2551 CDS 100% 5.625 3.938 N PKD2L1 n/a
8 TRCN0000434497 CTACAACAAGACCCTACTAAG pLKO_005 2213 CDS 100% 10.800 6.480 N PKD2L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016875.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07343 pDONR223 100% 83.8% 81.8% None (many diffs) n/a
2 ccsbBroad304_07343 pLX_304 0% 83.8% 81.8% V5 (many diffs) n/a
3 TRCN0000479162 GCTTTTTACAGAAGAATATCGCAT pLX_317 17% 83.8% 81.8% V5 (many diffs) n/a
Download CSV