Transcript: Human XM_017016878.2

PREDICTED: Homo sapiens B-TFIID TATA-box binding protein associated factor 1 (BTAF1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTAF1 (9044)
Length:
7894
CDS:
889..5829

Additional Resources:

NCBI RefSeq record:
XM_017016878.2
NBCI Gene record:
BTAF1 (9044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274253 TTAACGTATACCGATTGATAA pLKO_005 5525 CDS 100% 13.200 18.480 N BTAF1 n/a
2 TRCN0000013343 CCTCCTATCTTTAGTCACTTT pLKO.1 6128 3UTR 100% 4.950 6.930 N BTAF1 n/a
3 TRCN0000274320 CCTCCTATCTTTAGTCACTTT pLKO_005 6128 3UTR 100% 4.950 6.930 N BTAF1 n/a
4 TRCN0000013345 GCCGAATTTGAAGTCCAAGAT pLKO.1 645 5UTR 100% 4.950 6.930 N BTAF1 n/a
5 TRCN0000274254 GCCGAATTTGAAGTCCAAGAT pLKO_005 645 5UTR 100% 4.950 6.930 N BTAF1 n/a
6 TRCN0000013346 CCCGGTTTAATAATGATCCAT pLKO.1 5351 CDS 100% 3.000 4.200 N BTAF1 n/a
7 TRCN0000274318 GAAACTCTGTTTACGTTATTA pLKO_005 1894 CDS 100% 15.000 10.500 N BTAF1 n/a
8 TRCN0000013347 GCCTGTGTAATGGAACAACTA pLKO.1 3787 CDS 100% 4.950 3.465 N BTAF1 n/a
9 TRCN0000274255 GCCTGTGTAATGGAACAACTA pLKO_005 3787 CDS 100% 4.950 3.465 N BTAF1 n/a
10 TRCN0000013344 CGCCAACATTAACAGGCCATT pLKO.1 4280 CDS 100% 4.050 2.835 N BTAF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000473265 CTGACTACCTTCCTCTTTTGTCCC pLX_317 9.5% 88.9% 88.9% V5 0_1ins609;3016T>A;3018C>T n/a
Download CSV