Transcript: Human XM_017017055.1

PREDICTED: Homo sapiens uncharacterized LOC100287896 (LOC100287896), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC100287896 (100287896)
Length:
2023
CDS:
335..1513

Additional Resources:

NCBI RefSeq record:
XM_017017055.1
NBCI Gene record:
LOC100287896 (100287896)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017055.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146901 CTGAAAGTGATGAGCAGATAT pLKO.1 672 CDS 100% 13.200 9.240 N LOC100287896 n/a
2 TRCN0000148306 CATTGTCCAATGGTGAAGTAA pLKO.1 1158 CDS 100% 5.625 3.938 N LOC100287896 n/a
3 TRCN0000148015 GAGCAAGAAATCATGTCAGTT pLKO.1 1322 CDS 100% 4.950 3.465 N LOC100287896 n/a
4 TRCN0000147679 GCATTCATAACAGAGCAAGAA pLKO.1 1310 CDS 100% 4.950 3.465 N LOC100287896 n/a
5 TRCN0000148103 GCTGATCATGAAACAAGCAAA pLKO.1 802 CDS 100% 4.950 3.465 N LOC100287896 n/a
6 TRCN0000147194 CATTCATTGTCCAATGGTGAA pLKO.1 1154 CDS 100% 4.050 2.835 N LOC100287896 n/a
7 TRCN0000147977 GTTTACTGGCAAGTTCAGTAA pLKO.1 964 CDS 100% 0.495 0.347 N LOC100287896 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017055.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13626 pDONR223 100% 76% 76% None 1_282del n/a
2 ccsbBroad304_13626 pLX_304 0% 76% 76% V5 1_282del n/a
3 TRCN0000473074 GTCGCCGGGCCAGAGCTTCTTCTT pLX_317 42.3% 76% 76% V5 1_282del n/a
Download CSV