Transcript: Human XM_017017291.1

PREDICTED: Homo sapiens discs large MAGUK scaffold protein 2 (DLG2), transcript variant X42, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DLG2 (1740)
Length:
5945
CDS:
45..1136

Additional Resources:

NCBI RefSeq record:
XM_017017291.1
NBCI Gene record:
DLG2 (1740)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017291.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006108 CGGCCAGTACAATGACAATTT pLKO.1 764 CDS 100% 13.200 18.480 N DLG2 n/a
2 TRCN0000006107 CGGATCAATGACGACTTGATA pLKO.1 597 CDS 100% 0.563 0.788 N DLG2 n/a
3 TRCN0000134126 CGGGATTTCTTGGCTATTTAT pLKO.1 4035 3UTR 100% 15.000 12.000 N DLG2 n/a
4 TRCN0000138602 CCACAGAATTGTCGGCCATTT pLKO.1 3998 3UTR 100% 10.800 8.640 N DLG2 n/a
5 TRCN0000137887 CCTCACTGAAACCTGTGCTTT pLKO.1 5309 3UTR 100% 4.950 3.465 N DLG2 n/a
6 TRCN0000006106 GAAGAGCATTTAGAAGAACAA pLKO.1 1165 3UTR 100% 4.950 3.465 N DLG2 n/a
7 TRCN0000134618 GCTGGTGAAATGAAATCTCTT pLKO.1 4982 3UTR 100% 4.950 3.465 N DLG2 n/a
8 TRCN0000134405 GCTATTTATTTGCAGGCCTTT pLKO.1 4047 3UTR 100% 4.050 2.835 N DLG2 n/a
9 TRCN0000137533 CTGCAAACTTTGTCCAGAGCT pLKO.1 3777 3UTR 100% 2.640 1.848 N DLG2 n/a
10 TRCN0000137863 GCAAACTTTGTCCAGAGCTCT pLKO.1 3779 3UTR 100% 2.640 1.848 N DLG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017291.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.