Transcript: Human XM_017017561.1

PREDICTED: Homo sapiens tripartite motif containing 49B (TRIM49B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM49B (283116)
Length:
1204
CDS:
5..1132

Additional Resources:

NCBI RefSeq record:
XM_017017561.1
NBCI Gene record:
TRIM49B (283116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237953 ACTTTCACCTCGGGCAAATAT pLKO_005 776 CDS 100% 15.000 7.500 Y TRIM49B n/a
2 TRCN0000429173 ACCAGCCGAGTAGGATTATTC pLKO_005 989 CDS 100% 13.200 6.600 Y TRIM49 n/a
3 TRCN0000240035 CATCAAGATGTACCCTATTTC pLKO_005 716 CDS 100% 13.200 6.600 Y TRIM49C n/a
4 TRCN0000237952 CCATCAAGATGTACCCTATTT pLKO_005 715 CDS 100% 13.200 6.600 Y TRIM49B n/a
5 TRCN0000240034 CTACCAGCCGAGTAGGATTAT pLKO_005 987 CDS 100% 13.200 6.600 Y TRIM49C n/a
6 TRCN0000240036 GACTTTCACCTCGGGCAAATA pLKO_005 775 CDS 100% 13.200 6.600 Y TRIM49C n/a
7 TRCN0000423963 AGACTTTCACCTCGGGCAAAT pLKO_005 774 CDS 100% 10.800 5.400 Y TRIM49 n/a
8 TRCN0000033923 CAGGGAGACAAAGAAGATGTT pLKO.1 292 CDS 100% 4.950 2.475 Y TRIM48 n/a
9 TRCN0000033886 CCTAATATACACCATCCCTAA pLKO.1 1060 CDS 100% 4.050 2.025 Y TRIM49 n/a
10 TRCN0000033922 CATCTGCATGAACTACTTCAT pLKO.1 52 CDS 100% 0.495 0.248 Y TRIM48 n/a
11 TRCN0000237955 TACCAGCCGAGTAGGATTATT pLKO_005 988 CDS 100% 0.000 0.000 Y TRIM49B n/a
12 TRCN0000033921 GAATGTGGAAACCACCAGAAT pLKO.1 478 CDS 100% 4.950 2.475 Y TRIM48 n/a
13 TRCN0000033920 GAGGAGCAAATGTGTGGCATT pLKO.1 269 CDS 100% 4.050 2.025 Y TRIM48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15934 pDONR223 0% 81.1% 78.5% None (many diffs) n/a
2 ccsbBroad304_15934 pLX_304 0% 81.1% 78.5% V5 (many diffs) n/a
3 TRCN0000476541 TCCAAACTTGTCGCGCACACCGTT pLX_317 25.8% 81.1% 78.5% V5 (many diffs) n/a
4 ccsbBroadEn_03779 pDONR223 100% 81.1% 78.5% None (many diffs) n/a
5 ccsbBroad304_03779 pLX_304 0% 81.1% 78.5% V5 (many diffs) n/a
6 TRCN0000479767 CGAAGACGCCTACTTGGGTCTACC pLX_317 25.8% 81.1% 78.5% V5 (many diffs) n/a
7 ccsbBroadEn_12545 pDONR223 100% 51.4% 47.7% None (many diffs) n/a
8 ccsbBroad304_12545 pLX_304 0% 51.4% 47.7% V5 (many diffs) n/a
9 TRCN0000474512 GGGAGGGCCCAAAGGTCCATTTTA pLX_317 79.8% 51.4% 47.7% V5 (many diffs) n/a
Download CSV