Transcript: Human XM_017017756.1

PREDICTED: Homo sapiens microtubule associated protein 6 (MAP6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP6 (4135)
Length:
1802
CDS:
71..1657

Additional Resources:

NCBI RefSeq record:
XM_017017756.1
NBCI Gene record:
MAP6 (4135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005179 GCTGACAATAAGGTCATTGAT pLKO.1 215 CDS 100% 5.625 7.875 N MAP6 n/a
2 TRCN0000005180 CCAGATGATAAGATGGTTCAT pLKO.1 143 CDS 100% 4.950 3.960 N MAP6 n/a
3 TRCN0000416088 GCTACAGTGCTCAGTTCAAAG pLKO_005 171 CDS 100% 10.800 7.560 N MAP6 n/a
4 TRCN0000005182 ACGGACATCAAGCCTGTGAAA pLKO.1 92 CDS 100% 4.950 3.465 N MAP6 n/a
5 TRCN0000005181 CCTAGTGTTCAGAGTTCCAAA pLKO.1 344 CDS 100% 4.950 3.465 N MAP6 n/a
6 TRCN0000202316 GACGACAAGGAGCAAAGCAAA pLKO.1 479 CDS 100% 4.950 3.465 N Map6 n/a
7 TRCN0000434247 GACGACAAGGAGCAAAGCAAA pLKO_005 479 CDS 100% 4.950 3.465 N MAP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10959 pDONR223 100% 91.6% 91.6% None 1_84del;216_263del n/a
2 ccsbBroad304_10959 pLX_304 0% 91.6% 91.6% V5 1_84del;216_263del n/a
3 TRCN0000472963 ACTTCTTGTGTCTCCCCCGAACAC pLX_317 35.4% 91.6% 91.6% V5 1_84del;216_263del n/a
Download CSV