Transcript: Human XM_017017868.1

PREDICTED: Homo sapiens pyruvate carboxylase (PC), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PC (5091)
Length:
4495
CDS:
582..4118

Additional Resources:

NCBI RefSeq record:
XM_017017868.1
NBCI Gene record:
PC (5091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078456 CGACTCTGTGAAACTCGCTAA pLKO.1 1460 CDS 100% 4.050 5.670 N PC n/a
2 TRCN0000078457 CCTCAACTACTTGCCCAACAT pLKO.1 2618 CDS 100% 4.950 3.960 N PC n/a
3 TRCN0000413496 ATGGGCATCCGCCTGGATAAT pLKO_005 1788 CDS 100% 13.200 9.240 N PC n/a
4 TRCN0000421328 ACCAGAAGGTGGTCGAGATTG pLKO_005 1393 CDS 100% 10.800 7.560 N PC n/a
5 TRCN0000430723 AGTATAAGCCCATCAAGAAAG pLKO_005 679 CDS 100% 10.800 7.560 N PC n/a
6 TRCN0000078455 GCCAAGGAGAACAACGTAGAT pLKO.1 897 CDS 100% 4.950 3.465 N PC n/a
7 TRCN0000078454 GCCCAGTTTATGGTGCAGAAT pLKO.1 3333 CDS 100% 4.950 3.465 N PC n/a
8 TRCN0000112428 GCACTACTTCATCGAGGTCAA pLKO.1 1538 CDS 100% 4.050 2.835 N Pcx n/a
9 TRCN0000325918 GCACTACTTCATCGAGGTCAA pLKO_005 1538 CDS 100% 4.050 2.835 N Pcx n/a
10 TRCN0000078453 CATGTTCATCTCTTGCCAAAT pLKO.1 4319 3UTR 100% 10.800 6.480 N PC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017868.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01147 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01147 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473268 GCGCCGCATAGCAAGTTATCCAAT pLX_317 14.6% 100% 100% V5 n/a
Download CSV