Transcript: Human XM_017017941.1

PREDICTED: Homo sapiens ankyrin repeat domain 49 (ANKRD49), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD49 (54851)
Length:
1950
CDS:
185..904

Additional Resources:

NCBI RefSeq record:
XM_017017941.1
NBCI Gene record:
ANKRD49 (54851)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322734 TGATGAACCGTTACGTCAAAC pLKO_005 768 CDS 100% 10.800 15.120 N ANKRD49 n/a
2 TRCN0000062045 CCTGATGAACCGTTACGTCAA pLKO.1 766 CDS 100% 4.050 5.670 N ANKRD49 n/a
3 TRCN0000062047 GTGCTTGTAAGTGGAATAATA pLKO.1 624 CDS 100% 15.000 10.500 N ANKRD49 n/a
4 TRCN0000322795 TGGATCTTTGTTGGGTATTTA pLKO_005 1234 3UTR 100% 15.000 10.500 N ANKRD49 n/a
5 TRCN0000062044 CTAGGGATGAAGATGAGTATA pLKO.1 492 CDS 100% 13.200 9.240 N ANKRD49 n/a
6 TRCN0000322794 TTCACCTCAGTCTTAACAATT pLKO_005 889 CDS 100% 13.200 9.240 N ANKRD49 n/a
7 TRCN0000322733 TAGGGATGAAGATGAGTATAC pLKO_005 493 CDS 100% 10.800 7.560 N ANKRD49 n/a
8 TRCN0000350658 TATTCCTACTGGTACTCAAAG pLKO_005 292 CDS 100% 10.800 7.560 N ANKRD49 n/a
9 TRCN0000062046 GAACACTTTAACCAACTTGAA pLKO.1 248 CDS 100% 4.950 3.465 N ANKRD49 n/a
10 TRCN0000062043 CCAAGAGAATTCCTTGGATTT pLKO.1 223 CDS 100% 0.000 0.000 N ANKRD49 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03469 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03469 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474445 TTCGACGTAGATCTATGGGCGTGC pLX_317 51.5% 100% 100% V5 n/a
Download CSV