Transcript: Human XM_017017954.1

PREDICTED: Homo sapiens ubiquitin specific peptidase 47 (USP47), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP47 (55031)
Length:
8133
CDS:
2224..5154

Additional Resources:

NCBI RefSeq record:
XM_017017954.1
NBCI Gene record:
USP47 (55031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007696 CCGAGGAACTAGATATGAGTA pLKO.1 2261 CDS 100% 4.950 6.930 N USP47 n/a
2 TRCN0000007693 GCGCAATACATGCAAGATAAA pLKO.1 2835 CDS 100% 13.200 10.560 N USP47 n/a
3 TRCN0000320562 GCGCAATACATGCAAGATAAA pLKO_005 2835 CDS 100% 13.200 10.560 N USP47 n/a
4 TRCN0000007692 CGGAATCATGTTGTGCACTAT pLKO.1 5330 3UTR 100% 4.950 3.960 N USP47 n/a
5 TRCN0000350342 CGGAATCATGTTGTGCACTAT pLKO_005 5330 3UTR 100% 4.950 3.960 N USP47 n/a
6 TRCN0000007695 GCAGCTTTCAAACAACATTTA pLKO.1 4213 CDS 100% 13.200 9.240 N USP47 n/a
7 TRCN0000320633 GCAGCTTTCAAACAACATTTA pLKO_005 4213 CDS 100% 13.200 9.240 N USP47 n/a
8 TRCN0000320564 AGCGCTGCTGGTGGTCATTAT pLKO_005 2518 CDS 100% 13.200 7.920 N USP47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12140 pDONR223 100% 16% 16% None 1_2457del;2673G>A n/a
2 ccsbBroad304_12140 pLX_304 0% 16% 16% V5 1_2457del;2673G>A n/a
3 TRCN0000492128 GTGCGATGTCCGATACTACTGTAG pLX_317 85.5% 16% 16% V5 1_2457del;2673G>A n/a
Download CSV