Transcript: Human XM_017017961.1

PREDICTED: Homo sapiens protein phosphatase 2 scaffold subunit Abeta (PPP2R1B), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP2R1B (5519)
Length:
3030
CDS:
29..1894

Additional Resources:

NCBI RefSeq record:
XM_017017961.1
NBCI Gene record:
PPP2R1B (5519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235514 ATCTTGGCGCGTTCGCTATAT pLKO_005 829 CDS 100% 13.200 18.480 N PPP2R1B n/a
2 TRCN0000002487 CGGAGGACGAATAGAGTTTAA pLKO.1 2635 3UTR 100% 13.200 18.480 N PPP2R1B n/a
3 TRCN0000010710 TGACCACTTTATTCTGCATTA pLKO.1 1560 CDS 100% 10.800 15.120 N PPP2R1B n/a
4 TRCN0000010711 CCCGAAGTGAATTGTTGCCAT pLKO.1 204 CDS 100% 2.640 3.696 N PPP2R1B n/a
5 TRCN0000002488 GCCCAGTTATTGTCTCAGGAT pLKO.1 758 CDS 100% 2.640 2.112 N PPP2R1B n/a
6 TRCN0000235516 TGATGAAGATGAGGTACTATT pLKO_005 244 CDS 100% 13.200 9.240 N PPP2R1B n/a
7 TRCN0000235515 TGCTATCCCAGGGCATCAAAT pLKO_005 524 CDS 100% 13.200 9.240 N PPP2R1B n/a
8 TRCN0000235513 TGTCAGTATTGCCCAGTTATT pLKO_005 748 CDS 100% 13.200 9.240 N PPP2R1B n/a
9 TRCN0000010712 GCCACCAACAACCTCATGAAA pLKO.1 1448 CDS 100% 5.625 3.938 N PPP2R1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13925 pDONR223 100% 91.2% .4% None (many diffs) n/a
2 ccsbBroad304_13925 pLX_304 0% 91.2% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV