Transcript: Human XM_017018270.1

PREDICTED: Homo sapiens AHNAK nucleoprotein (AHNAK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AHNAK (79026)
Length:
18556
CDS:
243..17714

Additional Resources:

NCBI RefSeq record:
XM_017018270.1
NBCI Gene record:
AHNAK (79026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127734 GCACTTGAAGATGCCCAAGAT pLKO.1 2477 CDS 100% 4.950 6.435 N AHNAK n/a
2 TRCN0000296590 TGGGTGCCACCATCTACTTTG pLKO_005 409 CDS 100% 10.800 7.560 N AHNAK n/a
3 TRCN0000130911 GCACCTGAAGATGCCTAAGAT pLKO.1 6758 CDS 100% 5.625 3.938 N AHNAK n/a
4 TRCN0000104948 TGCCACCATCTACTTTGACAA pLKO.1 413 CDS 100% 4.950 3.465 N Ahnak n/a
5 TRCN0000123212 GCAGCTCTGAAGTGGTTCTGA pLKO.1 565 CDS 100% 3.000 2.100 N AHNAK n/a
6 TRCN0000290133 GCAGCTCTGAAGTGGTTCTGA pLKO_005 565 CDS 100% 3.000 2.100 N AHNAK n/a
7 TRCN0000123213 CCCGTGAAGTCTTCAGCTCCT pLKO.1 544 CDS 100% 0.720 0.504 N AHNAK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12531 pDONR223 100% 2.4% 2% None (many diffs) n/a
2 ccsbBroad304_12531 pLX_304 0% 2.4% 2% V5 (many diffs) n/a
3 TRCN0000471494 GCATGTACCGCGGGTTGGTACAGG pLX_317 67.8% 2.4% 2% V5 (many diffs) n/a
4 ccsbBroadEn_08907 pDONR223 100% 2.4% 2% None (many diffs) n/a
5 ccsbBroad304_08907 pLX_304 0% 2.4% 2% V5 (many diffs) n/a
6 TRCN0000467297 TGTATCTAGCGAGGTCCATGAACG pLX_317 71.3% 2.4% 2% V5 (many diffs) n/a
Download CSV