Transcript: Human XM_017018278.1

PREDICTED: Homo sapiens chromosome 11 open reading frame 49 (C11orf49), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C11orf49 (79096)
Length:
1914
CDS:
583..1305

Additional Resources:

NCBI RefSeq record:
XM_017018278.1
NBCI Gene record:
C11orf49 (79096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161111 GATTTGCTGACCATGAAAGAA pLKO.1 571 5UTR 100% 5.625 7.875 N C11orf49 n/a
2 TRCN0000281313 GATTTGCTGACCATGAAAGAA pLKO_005 571 5UTR 100% 5.625 7.875 N C11orf49 n/a
3 TRCN0000162075 CCAGGTTCTTCACTGAATATT pLKO.1 240 5UTR 100% 15.000 10.500 N C11orf49 n/a
4 TRCN0000161479 GCAATTACTGTGTCCTGATTT pLKO.1 606 CDS 100% 13.200 9.240 N C11orf49 n/a
5 TRCN0000281311 GCAATTACTGTGTCCTGATTT pLKO_005 606 CDS 100% 13.200 9.240 N C11orf49 n/a
6 TRCN0000166369 CTCAAAGCACCGTGGAATCAA pLKO.1 1017 CDS 100% 5.625 3.938 N C11orf49 n/a
7 TRCN0000164041 CATGGACTGCTTGATGTCTTT pLKO.1 678 CDS 100% 4.950 3.465 N C11orf49 n/a
8 TRCN0000297952 CATGGACTGCTTGATGTCTTT pLKO_005 678 CDS 100% 4.950 3.465 N C11orf49 n/a
9 TRCN0000158660 CCATGAAAGAATATCACTGTT pLKO.1 581 5UTR 100% 4.950 3.465 N C11orf49 n/a
10 TRCN0000164657 GAGACTGACCTTCTATGGATT pLKO.1 984 CDS 100% 4.950 3.465 N C11orf49 n/a
11 TRCN0000164899 GTATGCCAGGGAACACACATT pLKO.1 269 5UTR 100% 4.950 3.465 N C11orf49 n/a
12 TRCN0000281391 GTATGCCAGGGAACACACATT pLKO_005 269 5UTR 100% 4.950 3.465 N C11orf49 n/a
13 TRCN0000163001 GACCTTCTATGGATTCCTCAT pLKO.1 990 CDS 100% 4.050 2.835 N C11orf49 n/a
14 TRCN0000161531 GAATATCACTGTTTGCTGCAA pLKO.1 589 CDS 100% 2.640 1.848 N C11orf49 n/a
15 TRCN0000165240 GCAATGTTCAGAGACTGACCT pLKO.1 974 CDS 100% 2.640 1.848 N C11orf49 n/a
16 TRCN0000281389 GCAATGTTCAGAGACTGACCT pLKO_005 974 CDS 100% 2.640 1.848 N C11orf49 n/a
17 TRCN0000159345 GAAGATATTAGCCAATATGGA pLKO.1 215 5UTR 100% 0.300 0.210 N C11orf49 n/a
18 TRCN0000165039 GCAATGGATGAAGAGCTGGAA pLKO.1 1087 CDS 100% 2.640 1.584 N C11orf49 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018278.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04050 pDONR223 100% 71.2% 71.2% None 0_1ins291 n/a
2 ccsbBroad304_04050 pLX_304 0% 71.2% 71.2% V5 0_1ins291 n/a
3 TRCN0000472324 TATATATCTGTACCCCTTAACACC pLX_317 42.2% 71.2% 71.2% V5 0_1ins291 n/a
4 ccsbBroadEn_04049 pDONR223 100% 52.5% 52.5% None 0_1ins291;532_720del n/a
5 ccsbBroad304_04049 pLX_304 0% 52.5% 52.5% V5 0_1ins291;532_720del n/a
6 TRCN0000477445 GCCAGTACTACACCTGCAGCGAAG pLX_317 57.3% 52.5% 52.5% V5 0_1ins291;532_720del n/a
Download CSV