Transcript: Human XM_017018708.1

PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase kinase 2 (CAMKK2), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMKK2 (10645)
Length:
2315
CDS:
670..1779

Additional Resources:

NCBI RefSeq record:
XM_017018708.1
NBCI Gene record:
CAMKK2 (10645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363096 TCGTCAAGTTGGCCTACAATG pLKO_005 710 CDS 100% 10.800 15.120 N CAMKK2 n/a
2 TRCN0000002300 AGTCAAACACATTCCCAGCTT pLKO.1 1599 CDS 100% 2.640 3.696 N CAMKK2 n/a
3 TRCN0000363121 GCCATGGGTGTGACACTATAC pLKO_005 1300 CDS 100% 10.800 7.560 N CAMKK2 n/a
4 TRCN0000002299 GTGAAGACCATGATACGTAAA pLKO.1 1636 CDS 100% 10.800 7.560 N CAMKK2 n/a
5 TRCN0000194684 CAATACCTACTATGCAATGAA pLKO.1 738 CDS 100% 5.625 3.938 N CAMKK2 n/a
6 TRCN0000002297 CGAGCGGATCATGTGTTTACA pLKO.1 1353 CDS 100% 5.625 3.938 N CAMKK2 n/a
7 TRCN0000002298 CCGTTTCTACTTCCAGGATCT pLKO.1 1044 CDS 100% 4.050 2.835 N CAMKK2 n/a
8 TRCN0000199090 CCTCTCATCCTTGAGCATCCA pLKO.1 248 5UTR 100% 2.640 1.848 N CAMKK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018708.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489004 CTGAGTCACCCCACTTCCGCACTA pLX_317 17.4% 65.1% 64.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489407 TCATTGGCTCTTTCTTGGTCAGCC pLX_317 18.3% 65% 64.2% V5 (many diffs) n/a
3 TRCN0000491777 CTGATCGGTCACTTAGGGTCTCAT pLX_317 27.7% 57.3% 56.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000474789 TAATACCAGACATGCCCCAAAATT pLX_317 64.5% 44.8% 4.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV