Transcript: Human XM_017018850.2

PREDICTED: Homo sapiens electron transfer flavoprotein regulatory factor 1 (ETFRF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ETFRF1 (144363)
Length:
2556
CDS:
1581..1853

Additional Resources:

NCBI RefSeq record:
XM_017018850.2
NBCI Gene record:
ETFRF1 (144363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064535 GCTATGAAACAACGCTATTAT pLKO.1 1809 CDS 100% 15.000 21.000 N ETFRF1 n/a
2 TRCN0000418931 CTTATTGCACAGGGCGAATTT pLKO_005 1743 CDS 100% 13.200 18.480 N ETFRF1 n/a
3 TRCN0000414661 TAGCTATACTACCGATCATAA pLKO_005 2059 3UTR 100% 13.200 18.480 N ETFRF1 n/a
4 TRCN0000064536 GCTGTATCTTGGACGAGACTA pLKO.1 1634 CDS 100% 4.950 3.960 N ETFRF1 n/a
5 TRCN0000064533 CCTCTAACTTAATAGGACTTA pLKO.1 2124 3UTR 100% 4.950 3.465 N ETFRF1 n/a
6 TRCN0000064537 CCTTAGGAAATACAGAGCTAT pLKO.1 1793 CDS 100% 4.950 3.465 N ETFRF1 n/a
7 TRCN0000064534 GCTTTGTACTTCCTTAGGAAA pLKO.1 1782 CDS 100% 4.950 3.465 N ETFRF1 n/a
8 TRCN0000241035 GAGAAGATCAAAGAACTTATC pLKO_005 1728 CDS 100% 10.800 6.480 N Etfrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018850.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13222 pDONR223 100% 97.7% 97.7% None 1_6delATGAAA n/a
2 ccsbBroad304_13222 pLX_304 0% 97.7% 97.7% V5 1_6delATGAAA n/a
3 TRCN0000466418 ACAACTCCCGTATCTCCTGCTAAG pLX_317 100% 97.7% 97.7% V5 1_6delATGAAA n/a
Download CSV