Transcript: Human XM_017018964.1

PREDICTED: Homo sapiens antagonist of mitotic exit network 1 homolog (AMN1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AMN1 (196394)
Length:
2083
CDS:
203..925

Additional Resources:

NCBI RefSeq record:
XM_017018964.1
NBCI Gene record:
AMN1 (196394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018964.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136433 CGAGAAGTGTTGGAGCAATTA pLKO.1 860 CDS 100% 13.200 10.560 N AMN1 n/a
2 TRCN0000135235 CCTGAACATCAAGCCTGTTAA pLKO.1 1411 3UTR 100% 13.200 9.240 N AMN1 n/a
3 TRCN0000134305 GCCACATCCATTCATTGATTT pLKO.1 1520 3UTR 100% 13.200 9.240 N AMN1 n/a
4 TRCN0000134595 GAAGTGTTGGAGCAATTAGTA pLKO.1 863 CDS 100% 5.625 3.938 N AMN1 n/a
5 TRCN0000136149 GCAAGTGACATGGACTGTTTA pLKO.1 901 CDS 100% 13.200 7.920 N AMN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018964.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13368 pDONR223 100% 89.5% 89.5% None 1_75del n/a
2 ccsbBroad304_13368 pLX_304 0% 89.5% 89.5% V5 1_75del n/a
3 TRCN0000477960 GGGTGCTAACACTTGGCTTAGTAC pLX_317 57% 89.5% 89.5% V5 1_75del n/a
Download CSV