Transcript: Human XM_017019034.2

PREDICTED: Homo sapiens rabphilin 3A (RPH3A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RPH3A (22895)
Length:
3847
CDS:
711..1751

Additional Resources:

NCBI RefSeq record:
XM_017019034.2
NBCI Gene record:
RPH3A (22895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019034.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419241 CATCGGCAAGTCCAATGATTA pLKO_005 1595 CDS 100% 13.200 18.480 N RPH3A n/a
2 TRCN0000220581 CCCGAATTCAATGAGGAGTTT pLKO.1 1509 CDS 100% 0.000 0.000 N RPH3A n/a
3 TRCN0000220580 CCTCTCAGTTTGGGTAAATTA pLKO.1 2035 3UTR 100% 15.000 10.500 N RPH3A n/a
4 TRCN0000419452 TTTGGCCACAATGAATTTATT pLKO_005 1128 CDS 100% 15.000 10.500 N RPH3A n/a
5 TRCN0000419397 CCTGCAGTGCACCATCATTAA pLKO_005 890 CDS 100% 13.200 9.240 N RPH3A n/a
6 TRCN0000435461 GAACCACGTGTCAAGTGATTA pLKO_005 1730 CDS 100% 13.200 9.240 N RPH3A n/a
7 TRCN0000436342 AGCGAGTGATTCCTATGAAAC pLKO_005 1216 CDS 100% 10.800 7.560 N RPH3A n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2118 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019034.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07812 pDONR223 100% 50% 50.1% None 0_1ins1032;231C>T;420T>C n/a
2 ccsbBroad304_07812 pLX_304 0% 50% 50.1% V5 0_1ins1032;231C>T;420T>C n/a
3 TRCN0000477369 CAACTCGTGAATAAGATCATACCT pLX_317 16.1% 50% 50.1% V5 0_1ins1032;231C>T;420T>C n/a
Download CSV