Transcript: Human XM_017019049.1

PREDICTED: Homo sapiens UHRF1 binding protein 1 like (UHRF1BP1L), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UHRF1BP1L (23074)
Length:
3741
CDS:
190..3669

Additional Resources:

NCBI RefSeq record:
XM_017019049.1
NBCI Gene record:
UHRF1BP1L (23074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248138 GTGCTCCTGTTCGATTAATAA pLKO_005 800 CDS 100% 15.000 10.500 N Uhrf1bp1l n/a
2 TRCN0000122061 CCTGATTATTTGCCTACAGAA pLKO.1 2872 CDS 100% 4.950 3.465 N UHRF1BP1L n/a
3 TRCN0000139676 CCTGCTAGTCAGACATCCATT pLKO.1 2743 CDS 100% 4.950 3.465 N UHRF1BP1L n/a
4 TRCN0000145287 GCAGATATTCATCTCCTAGTT pLKO.1 2596 CDS 100% 4.950 3.465 N UHRF1BP1L n/a
5 TRCN0000139975 GCACCTCTCCAGATTTACCAA pLKO.1 222 CDS 100% 3.000 2.100 N UHRF1BP1L n/a
6 TRCN0000144232 CCTCCCATCATTTAGTGATTT pLKO.1 1142 CDS 100% 13.200 7.920 N UHRF1BP1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000470089 AACAGTTCCGGATAACTTATAACC pLX_317 10.8% 87% 86.3% V5 (many diffs) n/a
2 ccsbBroadEn_15749 pDONR223 0% 44.8% 44.4% None (many diffs) n/a
Download CSV