Transcript: Human XM_017019201.1

PREDICTED: Homo sapiens dpy-19 like 2 (DPY19L2), transcript variant X23, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DPY19L2 (283417)
Length:
3780
CDS:
970..2301

Additional Resources:

NCBI RefSeq record:
XM_017019201.1
NBCI Gene record:
DPY19L2 (283417)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130196 CGCTGAGATACACAAAGACAT pLKO.1 1490 CDS 100% 4.950 2.970 N DPY19L2 n/a
2 TRCN0000128340 GCTGAGATACACAAAGACATT pLKO.1 1491 CDS 100% 4.950 2.970 N DPY19L2 n/a
3 TRCN0000434761 ATAGTGTGTACAGAGTATTAA pLKO_005 2270 CDS 100% 15.000 7.500 Y DPY19L2 n/a
4 TRCN0000128689 CCGTAATCAATGGAGCATAAT pLKO.1 1839 CDS 100% 13.200 6.600 Y DPY19L2 n/a
5 TRCN0000427668 CCTTACTTCACCACAGTATTT pLKO_005 2245 CDS 100% 13.200 6.600 Y DPY19L2 n/a
6 TRCN0000422868 GACGTGGGCAATAATTCTAAA pLKO_005 1236 CDS 100% 13.200 6.600 Y DPY19L2 n/a
7 TRCN0000128428 GCTCTGAAATGACATCCTTAA pLKO.1 2714 3UTR 100% 10.800 5.400 Y DPY19L2 n/a
8 TRCN0000167252 CCATTGTGAATCATCCACATT pLKO.1 1985 CDS 100% 4.950 2.475 Y DPY19L2P2 n/a
9 TRCN0000129667 CCGAATTTGACTTCATGGAAA pLKO.1 1460 CDS 100% 4.950 2.475 Y DPY19L2 n/a
10 TRCN0000167955 CATGTGTGTTATGGCTTCCTT pLKO.1 1713 CDS 100% 3.000 1.500 Y DPY19L2P2 n/a
11 TRCN0000168247 CCCGAATTTGACTTCATGGAA pLKO.1 1459 CDS 100% 3.000 1.500 Y DPY19L2P2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09943 pDONR223 100% 58.2% 58.1% None 0_1ins945;3_6delGGAGinsTCTC n/a
Download CSV