Transcript: Human XM_017019243.2

PREDICTED: Homo sapiens thyrotropin releasing hormone degrading enzyme (TRHDE), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRHDE (29953)
Length:
3011
CDS:
15..2930

Additional Resources:

NCBI RefSeq record:
XM_017019243.2
NBCI Gene record:
TRHDE (29953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430267 ACTACGTAGAGAAGTTATAAT pLKO_005 2450 CDS 100% 15.000 21.000 N TRHDE n/a
2 TRCN0000073837 GCACCACAGAATAACTTATTT pLKO.1 2012 CDS 100% 15.000 21.000 N TRHDE n/a
3 TRCN0000421941 GGACTATGCTCTCCATATAAC pLKO_005 1112 CDS 100% 13.200 18.480 N TRHDE n/a
4 TRCN0000437101 ACAACGCGCTCATCGAGAATG pLKO_005 724 CDS 100% 10.800 15.120 N TRHDE n/a
5 TRCN0000419696 GTTTGACTGGATCGCATATAA pLKO_005 1577 CDS 100% 15.000 12.000 N TRHDE n/a
6 TRCN0000073835 CCAGTGTTTCATCTATTTCTT pLKO.1 1282 CDS 100% 5.625 3.938 N TRHDE n/a
7 TRCN0000073834 GCCAATCTACAAGGCTACTTT pLKO.1 857 CDS 100% 5.625 3.938 N TRHDE n/a
8 TRCN0000073836 GCTGGCTATTTGCCTCAGAAT pLKO.1 2202 CDS 100% 4.950 3.465 N TRHDE n/a
9 TRCN0000031103 GCCAGAAATGATCTCTGGAAT pLKO.1 1701 CDS 100% 0.495 0.347 N Trhde n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03116 pDONR223 100% 94.4% 92.4% None (many diffs) n/a
2 ccsbBroad304_03116 pLX_304 0% 94.4% 92.4% V5 (many diffs) n/a
3 TRCN0000477129 GCTTAACCAACCCTCTTTTCAAAC pLX_317 13.2% 94.4% 92.4% V5 (many diffs) n/a
Download CSV