Transcript: Human XM_017019294.1

PREDICTED: Homo sapiens keratin 7 (KRT7), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KRT7 (3855)
Length:
1424
CDS:
385..1263

Additional Resources:

NCBI RefSeq record:
XM_017019294.1
NBCI Gene record:
KRT7 (3855)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019294.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116347 ACCCACAATCACAAGAAGATT pLKO.1 1297 3UTR 100% 5.625 3.938 N KRT7 n/a
2 TRCN0000315722 ACCCACAATCACAAGAAGATT pLKO_005 1297 3UTR 100% 5.625 3.938 N KRT7 n/a
3 TRCN0000116349 CCGTGAATATCTCTGTGATGA pLKO.1 1082 CDS 100% 4.950 3.465 N KRT7 n/a
4 TRCN0000315724 CCGTGAATATCTCTGTGATGA pLKO_005 1082 CDS 100% 4.950 3.465 N KRT7 n/a
5 TRCN0000116348 CCTGAATGATGAGATCAACTT pLKO.1 504 CDS 100% 4.950 3.465 N KRT7 n/a
6 TRCN0000315723 CCTGAATGATGAGATCAACTT pLKO_005 504 CDS 100% 4.950 3.465 N KRT7 n/a
7 TRCN0000116350 CCCGGAATGAGATTTCAGAGA pLKO.1 764 CDS 100% 2.640 1.848 N KRT7 n/a
8 TRCN0000315656 CCCGGAATGAGATTTCAGAGA pLKO_005 764 CDS 100% 2.640 1.848 N KRT7 n/a
9 TRCN0000084030 CAACAAGTTTGCCTCCTTCAT pLKO.1 2 5UTR 100% 4.950 2.475 Y KRT6A n/a
10 TRCN0000116954 CCTCCTTCATCGACAAGGTAT pLKO.1 13 5UTR 100% 4.950 2.475 Y KRT8P11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019294.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06505 pDONR223 100% 60.9% 57.9% None (many diffs) n/a
2 ccsbBroad304_06505 pLX_304 0% 60.9% 57.9% V5 (many diffs) n/a
3 TRCN0000478346 GCTAGCTAAGGGCTCACTTAAAAA pLX_317 23.6% 60.9% 57.9% V5 (many diffs) n/a
Download CSV