Transcript: Human XM_017019370.2

PREDICTED: Homo sapiens phenylalanine hydroxylase (PAH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAH (5053)
Length:
1794
CDS:
115..837

Additional Resources:

NCBI RefSeq record:
XM_017019370.2
NBCI Gene record:
PAH (5053)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056610 GCCAAAGTATTGCGCTTATTT pLKO.1 259 CDS 100% 15.000 21.000 N PAH n/a
2 TRCN0000435532 CCATGAGCTTTCACGAGATAA pLKO_005 432 CDS 100% 13.200 18.480 N PAH n/a
3 TRCN0000056608 CGGAAGCAGTTTGCTGACATT pLKO.1 586 CDS 100% 4.950 3.960 N PAH n/a
4 TRCN0000433552 TCTAGACCTTCTCGTTTAAAG pLKO_005 313 CDS 100% 13.200 9.240 N PAH n/a
5 TRCN0000056611 CGAGTGGAATACATGGAGGAA pLKO.1 640 CDS 100% 2.640 1.848 N PAH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06685 pDONR223 100% 52.4% 51.7% None (many diffs) n/a
2 ccsbBroad304_06685 pLX_304 0% 52.4% 51.7% V5 (many diffs) n/a
3 TRCN0000473451 TCCATCCACTCCCCCTTCTAACAA pLX_317 33.9% 52.4% 51.7% V5 (many diffs) n/a
Download CSV