Transcript: Human XM_017019454.1

PREDICTED: Homo sapiens 5'-nucleotidase domain containing 3 (NT5DC3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NT5DC3 (51559)
Length:
2463
CDS:
83..1216

Additional Resources:

NCBI RefSeq record:
XM_017019454.1
NBCI Gene record:
NT5DC3 (51559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167672 GCAGTATTAATGAAGATCGAT pLKO.1 551 CDS 100% 3.000 4.200 N NT5DC3 n/a
2 TRCN0000167103 CCTGTCAGACATTGAAATCTA pLKO.1 358 CDS 100% 5.625 3.938 N NT5DC3 n/a
3 TRCN0000168209 CTCTCATGGAAACACGATGAA pLKO.1 700 CDS 100% 4.950 3.465 N NT5DC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019454.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03334 pDONR223 100% 66.1% 60.9% None (many diffs) n/a
2 ccsbBroad304_03334 pLX_304 0% 66.1% 60.9% V5 (many diffs) n/a
3 TRCN0000477695 TGCACGACCCTAAAAAGAGGGTAT pLX_317 8.7% 66.1% 60.9% V5 (many diffs) n/a
Download CSV