Transcript: Human XM_017019494.1

PREDICTED: Homo sapiens slingshot protein phosphatase 1 (SSH1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SSH1 (54434)
Length:
8423
CDS:
916..3129

Additional Resources:

NCBI RefSeq record:
XM_017019494.1
NBCI Gene record:
SSH1 (54434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272724 TTACCAGAGAAATCGATAATT pLKO_005 1001 CDS 100% 15.000 21.000 N SSH1 n/a
2 TRCN0000382505 TGGCTTATTTGCATATCATAA pLKO_005 1029 CDS 100% 13.200 18.480 N SSH1 n/a
3 TRCN0000003086 CGGCACACGTTCTAGCTCATT pLKO.1 3497 3UTR 100% 4.950 6.930 N SSH1 n/a
4 TRCN0000272673 CGGCACACGTTCTAGCTCATT pLKO_005 3497 3UTR 100% 4.950 6.930 N SSH1 n/a
5 TRCN0000272672 CATGGAGGATGATGCTATATT pLKO_005 1866 CDS 100% 15.000 10.500 N SSH1 n/a
6 TRCN0000272726 AGACAATGAGATGCTACTTAT pLKO_005 911 5UTR 100% 13.200 9.240 N SSH1 n/a
7 TRCN0000382358 ACTTCCAAAGAGATTCGTAAT pLKO_005 840 5UTR 100% 10.800 7.560 N SSH1 n/a
8 TRCN0000003087 GCCTCCACAGTCATAGCCTAT pLKO.1 1180 CDS 100% 4.050 2.835 N SSH1 n/a
9 TRCN0000003084 GCTGTCTGAGTATGAAGGCAT pLKO.1 1296 CDS 100% 2.640 1.848 N SSH1 n/a
10 TRCN0000010758 TGAGGATGAAACTGGCAGCTT pLKO.1 1545 CDS 100% 2.640 1.848 N SSH1 n/a
11 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 5715 3UTR 100% 4.950 2.475 Y DENND6A n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5883 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08375 pDONR223 100% 70.1% 68.4% None (many diffs) n/a
2 ccsbBroad304_08375 pLX_304 0% 70.1% 68.4% V5 (many diffs) n/a
3 TRCN0000491290 CATCCCTAGGTAATGCTTTCTCGA pLX_317 8.6% 70.1% 68.4% V5 (many diffs) n/a
Download CSV