Transcript: Human XM_017019617.2

PREDICTED: Homo sapiens solute carrier family 48 member 1 (SLC48A1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC48A1 (55652)
Length:
1082
CDS:
98..538

Additional Resources:

NCBI RefSeq record:
XM_017019617.2
NBCI Gene record:
SLC48A1 (55652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019617.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414549 ATCAGCATCCTCAGCGATTTC pLKO_005 515 CDS 100% 10.800 6.480 N SLC48A1 n/a
2 TRCN0000190335 CTGGAGCTTCATTTCCTTCAA pLKO.1 439 CDS 100% 4.950 2.970 N Slc48a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019617.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03622 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03622 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_12240 pDONR223 100% 60.9% 60.9% None 1_171del n/a
4 ccsbBroad304_12240 pLX_304 0% 60.9% 60.9% V5 1_171del n/a
5 TRCN0000465396 ATGTGTGAGAATGTTATACCAGTC pLX_317 100% 60.9% 60.9% V5 1_171del n/a
Download CSV