Transcript: Human XM_017019643.1

PREDICTED: Homo sapiens LIM domain only 3 (LMO3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LMO3 (55885)
Length:
3954
CDS:
767..1144

Additional Resources:

NCBI RefSeq record:
XM_017019643.1
NBCI Gene record:
LMO3 (55885)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016256 ACGGACTACGAGGAAGGTTTA pLKO.1 1091 CDS 100% 10.800 15.120 N LMO3 n/a
2 TRCN0000016257 GCTCTTTGGTGTAACGGGAAA pLKO.1 913 CDS 100% 4.050 5.670 N LMO3 n/a
3 TRCN0000016255 GCGTGCCAAGGACAATGTTTA pLKO.1 979 CDS 100% 13.200 10.560 N LMO3 n/a
4 TRCN0000424589 CAAGGACCGGTATCTTCTAAA pLKO_005 568 5UTR 100% 13.200 9.240 N LMO3 n/a
5 TRCN0000430735 GTACACTAAAGCTAATCTTAT pLKO_005 670 5UTR 100% 13.200 9.240 N LMO3 n/a
6 TRCN0000016253 CTGGACAAATACTGGCATGAA pLKO.1 593 5UTR 100% 4.950 3.465 N LMO3 n/a
7 TRCN0000016254 GTCAGCTTTGTAATCAGAGAT pLKO.1 1020 CDS 100% 4.950 3.465 N LMO3 n/a
8 TRCN0000430059 TGCATCTGTATGTAGTGAAAT pLKO_005 1290 3UTR 100% 13.200 7.920 N LMO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03676 pDONR223 100% 69.4% 54.3% None (many diffs) n/a
2 ccsbBroad304_03676 pLX_304 0% 69.4% 54.3% V5 (many diffs) n/a
3 TRCN0000467106 AGCGATGATACCCTAACGCCTAGG pLX_317 70.9% 69.4% 54.3% V5 (many diffs) n/a
Download CSV