Transcript: Human XM_017019983.2

PREDICTED: Homo sapiens centrosomal protein 290 (CEP290), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP290 (80184)
Length:
7943
CDS:
345..7772

Additional Resources:

NCBI RefSeq record:
XM_017019983.2
NBCI Gene record:
CEP290 (80184)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276333 ATCTCGGAAAGAGGCTATAAA pLKO_005 2486 CDS 100% 15.000 21.000 N CEP290 n/a
2 TRCN0000141540 CAGTGACTACCGATCACAGTT pLKO.1 926 CDS 100% 4.950 6.930 N CEP290 n/a
3 TRCN0000276332 CAGTGACTACCGATCACAGTT pLKO_005 926 CDS 100% 4.950 6.930 N CEP290 n/a
4 TRCN0000145444 GAAGAACGACTTGATCTGAAA pLKO.1 1962 CDS 100% 4.950 3.960 N CEP290 n/a
5 TRCN0000285535 GAAGAACGACTTGATCTGAAA pLKO_005 1962 CDS 100% 4.950 3.960 N CEP290 n/a
6 TRCN0000144115 CAAATTAAGATGCTCACCGAA pLKO.1 1410 CDS 100% 2.640 2.112 N CEP290 n/a
7 TRCN0000285536 GAACTAGAACTGGCTAATAAA pLKO_005 3204 CDS 100% 15.000 10.500 N CEP290 n/a
8 TRCN0000145392 GAAGATGCTGTCGTTGAAATA pLKO.1 1698 CDS 100% 13.200 9.240 N CEP290 n/a
9 TRCN0000145550 CCAATTATGGTAGCTGTCAAT pLKO.1 1224 CDS 100% 4.950 3.465 N CEP290 n/a
10 TRCN0000142313 GAGCTGGCTTTGGAAGAAGTA pLKO.1 543 CDS 100% 4.950 3.465 N CEP290 n/a
11 TRCN0000276334 GAGCTGGCTTTGGAAGAAGTA pLKO_005 543 CDS 100% 4.950 3.465 N CEP290 n/a
12 TRCN0000145008 GAGCTTACAGATCTTCTGAAA pLKO.1 1182 CDS 100% 4.950 3.465 N CEP290 n/a
13 TRCN0000141320 CGTCAAGAAGAACTGGCAGAT pLKO.1 402 CDS 100% 4.050 2.835 N CEP290 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14281 pDONR223 100% 6.5% 6.5% None (many diffs) n/a
2 ccsbBroad304_14281 pLX_304 0% 6.5% 6.5% V5 (many diffs) n/a
3 TRCN0000473474 TTGTATCTCTTCCGAGTCCTCCGT pLX_317 71.2% 6.5% 6.5% V5 (many diffs) n/a
Download CSV