Transcript: Human XM_017019988.1

PREDICTED: Homo sapiens dual specificity phosphatase 16 (DUSP16), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DUSP16 (80824)
Length:
4938
CDS:
772..2325

Additional Resources:

NCBI RefSeq record:
XM_017019988.1
NBCI Gene record:
DUSP16 (80824)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019988.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052013 CCGGCCATTTGTGGAATACAA pLKO.1 584 5UTR 100% 5.625 7.875 N DUSP16 n/a
2 TRCN0000303835 CATTTGAGAGATCAGCTAATA pLKO_005 2495 3UTR 100% 13.200 9.240 N DUSP16 n/a
3 TRCN0000052017 GCAACAGGACAAAGTGTTAAT pLKO.1 665 5UTR 100% 13.200 9.240 N DUSP16 n/a
4 TRCN0000310527 GCAACAGGACAAAGTGTTAAT pLKO_005 665 5UTR 100% 13.200 9.240 N DUSP16 n/a
5 TRCN0000379533 GATCTCAAATATTAGTCTTTG pLKO_005 2677 3UTR 100% 10.800 7.560 N DUSP16 n/a
6 TRCN0000052015 CATCAGAAGATGCTTTGGAAT pLKO.1 1592 CDS 100% 4.950 3.465 N DUSP16 n/a
7 TRCN0000299955 CATCAGAAGATGCTTTGGAAT pLKO_005 1592 CDS 100% 4.950 3.465 N DUSP16 n/a
8 TRCN0000052016 GCCTCCAATGGATGTGTTCTA pLKO.1 1030 CDS 100% 4.950 3.465 N DUSP16 n/a
9 TRCN0000299953 GCCTCCAATGGATGTGTTCTA pLKO_005 1030 CDS 100% 4.950 3.465 N DUSP16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019988.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09053 pDONR223 100% 77.6% 72% None (many diffs) n/a
2 ccsbBroad304_09053 pLX_304 0% 77.6% 72% V5 (many diffs) n/a
3 TRCN0000480153 ATAGCTACAGGCGAGTTACGCAGT pLX_317 19.9% 77.6% 72% V5 (many diffs) n/a
Download CSV