Transcript: Human XM_017019990.1

PREDICTED: Homo sapiens solute carrier family 38 member 1 (SLC38A1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC38A1 (81539)
Length:
2232
CDS:
724..2094

Additional Resources:

NCBI RefSeq record:
XM_017019990.1
NBCI Gene record:
SLC38A1 (81539)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043899 GCCAATTTACAGTGAGCTTAA pLKO.1 1602 CDS 100% 10.800 15.120 N SLC38A1 n/a
2 TRCN0000043900 CCTCCTATTGATCTGTTCAAA pLKO.1 1083 CDS 100% 5.625 4.500 N SLC38A1 n/a
3 TRCN0000301026 CCTCCTATTGATCTGTTCAAA pLKO_005 1083 CDS 100% 5.625 4.500 N SLC38A1 n/a
4 TRCN0000043902 CGTAGGAGTTACATCTGCTAA pLKO.1 1983 CDS 100% 4.950 3.960 N SLC38A1 n/a
5 TRCN0000301091 CGTAGGAGTTACATCTGCTAA pLKO_005 1983 CDS 100% 4.950 3.960 N SLC38A1 n/a
6 TRCN0000043901 CCTGCATTGTTCCAGAGCTAA pLKO.1 1454 CDS 100% 4.950 3.465 N SLC38A1 n/a
7 TRCN0000301016 CCTGCATTGTTCCAGAGCTAA pLKO_005 1454 CDS 100% 4.950 3.465 N SLC38A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14290 pDONR223 100% 93.4% 93% None (many diffs) n/a
2 ccsbBroad304_14290 pLX_304 0% 93.4% 93% V5 (many diffs) n/a
3 TRCN0000473078 GCGTTTCTGTTTATCTGACGGTTT pLX_317 28.2% 93.4% 93% V5 (many diffs) n/a
Download CSV