Transcript: Human XM_017020214.1

PREDICTED: Homo sapiens PC-esterase domain containing 1B (PCED1B), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCED1B (91523)
Length:
2511
CDS:
915..2213

Additional Resources:

NCBI RefSeq record:
XM_017020214.1
NBCI Gene record:
PCED1B (91523)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416248 AGACGGACCTAGGCCTTATTT pLKO_005 2212 CDS 100% 15.000 21.000 N PCED1B n/a
2 TRCN0000129275 CGAAGTGGTCAAAGCCAACTT pLKO.1 1487 CDS 100% 4.950 6.930 N PCED1B n/a
3 TRCN0000129162 GCACGTAAACATAACTTCGAT pLKO.1 1524 CDS 100% 3.000 4.200 N PCED1B n/a
4 TRCN0000412955 GTTTCTTCGTCGAAGACAATT pLKO_005 2011 CDS 100% 13.200 10.560 N PCED1B n/a
5 TRCN0000131198 GCAGCCTGACTCATTCTTCTT pLKO.1 2376 3UTR 100% 4.950 3.465 N PCED1B n/a
6 TRCN0000130994 CTCTGTGCATAGGGCAGTATA pLKO.1 983 CDS 100% 13.200 7.920 N PCED1B n/a
7 TRCN0000129320 CCATCTTGAAAGAGCTGCAGT pLKO.1 1225 CDS 100% 2.640 1.584 N PCED1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020214.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04547 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04547 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481361 GTACCGTCGAAGACCCCGAGGAGC pLX_317 32.6% 100% 100% V5 n/a
4 ccsbBroadEn_12960 pDONR223 100% 63.3% 45.4% None 1_360del;929_1037del;1296_1297insTAGACGGACC n/a
5 ccsbBroad304_12960 pLX_304 0% 63.3% 45.4% V5 1_360del;929_1037del;1296_1297insTAGACGGACC n/a
6 TRCN0000469978 GTCAATACACGCCATTACGTTCAT pLX_317 25.4% 63.3% 45.4% V5 1_360del;929_1037del;1296_1297insTAGACGGACC n/a
Download CSV