Transcript: Human XM_017020234.1

PREDICTED: Homo sapiens CD27 molecule (CD27), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD27 (939)
Length:
1450
CDS:
230..1306

Additional Resources:

NCBI RefSeq record:
XM_017020234.1
NBCI Gene record:
CD27 (939)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003599 CTTACCTTATGTCAGTGAGAT pLKO.1 661 CDS 100% 4.950 3.465 N CD27 n/a
2 TRCN0000003596 GCACTGTAACTCTGGTCTTCT pLKO.1 484 CDS 100% 4.950 3.465 N CD27 n/a
3 TRCN0000003598 CCACCCACTTACCTTATGTCA pLKO.1 654 CDS 100% 3.000 2.100 N CD27 n/a
4 TRCN0000003595 GCCAGATGTGTGAGCCAGGAA pLKO.1 348 CDS 100% 0.880 0.616 N CD27 n/a
5 TRCN0000003597 CGAAAGACCCACATGCTACAA pLKO.1 1394 3UTR 100% 4.950 2.475 Y CD27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00253 pDONR223 100% 72.5% 63.1% None 659_770del;810A>G;893_1074del n/a
2 ccsbBroad304_00253 pLX_304 0% 72.5% 63.1% V5 659_770del;810A>G;893_1074del n/a
3 TRCN0000468448 CCCACCGCTCAATTGTTCGTAGCC pLX_317 56.6% 72.5% 63.1% V5 659_770del;810A>G;893_1074del n/a
Download CSV