Transcript: Human XM_017020239.2

PREDICTED: Homo sapiens calcium binding protein 1 (CABP1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CABP1 (9478)
Length:
3946
CDS:
2918..3526

Additional Resources:

NCBI RefSeq record:
XM_017020239.2
NBCI Gene record:
CABP1 (9478)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029359 CGAGATGCTTTCCGAGAGTTT pLKO.1 3230 CDS 100% 4.950 6.930 N CABP1 n/a
2 TRCN0000029362 GTCCCAGCAGATCAACATGAA pLKO.1 3115 CDS 100% 4.950 3.960 N CABP1 n/a
3 TRCN0000029360 CCGAGACATAGAGGAAATTAT pLKO.1 3331 CDS 100% 15.000 10.500 N CABP1 n/a
4 TRCN0000414193 ACAGCAGATATGATTGGTGTA pLKO_005 3200 CDS 100% 4.050 2.835 N CABP1 n/a
5 TRCN0000029361 CTGCGACCAGAGGAAATTGAA pLKO.1 2972 CDS 100% 5.625 3.375 N CABP1 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3915 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 119 5UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000029363 GAGAAATCTCTCAAGGAAGAT pLKO.1 2944 CDS 100% 4.950 3.465 N CABP1 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 119 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11372 pDONR223 100% 47.6% 43.6% None (many diffs) n/a
2 ccsbBroad304_11372 pLX_304 0% 47.6% 43.6% V5 (many diffs) n/a
3 TRCN0000467078 GTACCATCTACACTATCAATTAAC pLX_317 44.3% 47.6% 43.6% V5 (many diffs) n/a
Download CSV