Transcript: Human XM_017020536.2

PREDICTED: Homo sapiens sodium leak channel, non-selective (NALCN), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NALCN (259232)
Length:
5987
CDS:
392..5161

Additional Resources:

NCBI RefSeq record:
XM_017020536.2
NBCI Gene record:
NALCN (259232)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020536.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044433 CGGTGGAGTAATGGACATATT pLKO.1 2803 CDS 100% 13.200 18.480 N NALCN n/a
2 TRCN0000420381 TTCGAACTACTACTCGTAATT pLKO_005 1301 CDS 100% 13.200 18.480 N NALCN n/a
3 TRCN0000044435 GCACGCTTCAACGCATCTAAA pLKO.1 2510 CDS 100% 13.200 10.560 N NALCN n/a
4 TRCN0000413962 GCCGATCCATGGAATCTATAT pLKO_005 3331 CDS 100% 13.200 10.560 N NALCN n/a
5 TRCN0000044436 CCCAACATTATTAGAAGGGAA pLKO.1 3089 CDS 100% 2.640 1.848 N NALCN n/a
6 TRCN0000044437 GCCATCTATTTCATTCTCTAT pLKO.1 1670 CDS 100% 4.950 2.970 N NALCN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020536.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13485 pDONR223 100% 27.9% 21.5% None (many diffs) n/a
2 ccsbBroad304_13485 pLX_304 0% 27.9% 21.5% V5 (many diffs) n/a
3 TRCN0000476819 AGTCCACTTCATTGGAAGCTGTTC pLX_317 18.1% 27.9% 21.5% V5 (many diffs) n/a
Download CSV