Transcript: Human XM_017020607.1

PREDICTED: Homo sapiens propionyl-CoA carboxylase subunit alpha (PCCA), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCCA (5095)
Length:
3465
CDS:
17..2152

Additional Resources:

NCBI RefSeq record:
XM_017020607.1
NBCI Gene record:
PCCA (5095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421850 ATTACTTCGAGAGGTGATAAT pLKO_005 1366 CDS 100% 13.200 18.480 N PCCA n/a
2 TRCN0000078427 GCAGTTGAATGTCGGGTTTAT pLKO.1 1100 CDS 100% 13.200 18.480 N PCCA n/a
3 TRCN0000339286 GCAGTTGAATGTCGGGTTTAT pLKO_005 1100 CDS 100% 13.200 18.480 N Pcca n/a
4 TRCN0000078425 GCGACAAGATTGAAAGCAAAT pLKO.1 441 CDS 100% 10.800 7.560 N PCCA n/a
5 TRCN0000078424 CCAGGAAGTGATATTAGCATT pLKO.1 1226 CDS 100% 4.950 3.465 N PCCA n/a
6 TRCN0000078426 GCAGGTGGAAACATGAGCATT pLKO.1 1857 CDS 100% 4.950 3.465 N PCCA n/a
7 TRCN0000078423 CGTCATATAGAAATCCAGGTT pLKO.1 719 CDS 100% 2.640 1.848 N PCCA n/a
8 TRCN0000112466 CGAAACTAAATGTGACCAGTA pLKO.1 1680 CDS 100% 4.050 3.240 N Pcca n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11018 pDONR223 100% 85.4% 80.6% None (many diffs) n/a
2 ccsbBroad304_11018 pLX_304 0% 85.4% 80.6% V5 (many diffs) n/a
3 TRCN0000477380 CACATGCGCCTAGGTGTCCATTCG pLX_317 21.2% 85.4% 80.6% V5 (many diffs) n/a
Download CSV