Transcript: Human XM_017020675.2

PREDICTED: Homo sapiens DnaJ heat shock protein family (Hsp40) member C3 (DNAJC3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAJC3 (5611)
Length:
6100
CDS:
991..2142

Additional Resources:

NCBI RefSeq record:
XM_017020675.2
NBCI Gene record:
DNAJC3 (5611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146369 CAGTCGCAGAAACGAGATTAT pLKO.1 1792 CDS 100% 13.200 18.480 N DNAJC3 n/a
2 TRCN0000149107 GCTGCGTCAAAGTTGAAGAAT pLKO.1 1264 CDS 100% 5.625 4.500 N DNAJC3 n/a
3 TRCN0000149046 GAGCCAAGCATTGCTGAATAT pLKO.1 1519 CDS 100% 13.200 9.240 N DNAJC3 n/a
4 TRCN0000147154 CCAGATAACTTCCAGAATGAA pLKO.1 1894 CDS 100% 5.625 3.938 N DNAJC3 n/a
5 TRCN0000148819 CACCCAGATAACTTCCAGAAT pLKO.1 1891 CDS 100% 4.950 3.465 N DNAJC3 n/a
6 TRCN0000149137 GTTCGTTCAAAGGAGAGGATT pLKO.1 1543 CDS 100% 4.950 3.465 N DNAJC3 n/a
7 TRCN0000146997 CCAGCAAATATGAATCTGTCA pLKO.1 1490 CDS 100% 2.640 1.848 N DNAJC3 n/a
8 TRCN0000149484 GTGGAGATTATACTGCTGCTA pLKO.1 1127 CDS 100% 2.640 1.848 N DNAJC3 n/a
9 TRCN0000149287 GCTAAAGAAGTCCTCTCTGAT pLKO.1 1960 CDS 100% 4.950 2.970 N DNAJC3 n/a
10 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 465 5UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020675.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01293 pDONR223 100% 75.5% 73.9% None (many diffs) n/a
2 ccsbBroad304_01293 pLX_304 0% 75.5% 73.9% V5 (many diffs) n/a
3 TRCN0000466430 AGCAGCAGATACCCGAAGAAGGCT pLX_317 28.9% 75.5% 73.9% V5 (many diffs) n/a
Download CSV