Transcript: Human XM_017020678.2

PREDICTED: Homo sapiens kelch like family member 1 (KLHL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHL1 (57626)
Length:
3071
CDS:
235..1962

Additional Resources:

NCBI RefSeq record:
XM_017020678.2
NBCI Gene record:
KLHL1 (57626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020678.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422113 GTTAGTTCGGGAATGGTTATT pLKO_005 2178 3UTR 100% 13.200 18.480 N KLHL1 n/a
2 TRCN0000439112 GTTCCCGGCTACTGGATTATG pLKO_005 1703 CDS 100% 13.200 18.480 N KLHL1 n/a
3 TRCN0000113833 CCACAGATATTGGCTGACCTA pLKO.1 937 CDS 100% 2.640 2.112 N KLHL1 n/a
4 TRCN0000113835 GCAGCAACTTTGTGATGTTAT pLKO.1 339 CDS 100% 13.200 9.240 N KLHL1 n/a
5 TRCN0000113831 CCTACTAATCAAAGCTGCATA pLKO.1 2554 3UTR 100% 4.950 3.465 N KLHL1 n/a
6 TRCN0000113834 CCTTTGAGTATGCCCAGAGAT pLKO.1 1768 CDS 100% 4.950 3.465 N KLHL1 n/a
7 TRCN0000113832 GCGGCCATGTTTACAAGTGAT pLKO.1 427 CDS 100% 4.950 3.465 N KLHL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020678.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08750 pDONR223 100% 76.7% 76.7% None (many diffs) n/a
2 ccsbBroad304_08750 pLX_304 0% 76.7% 76.7% V5 (many diffs) n/a
3 TRCN0000469355 GGTCAGGACTTCCGGCACCAGCCA pLX_317 17.2% 76.7% 76.7% V5 (many diffs) n/a
Download CSV