Transcript: Human XM_017020713.2

PREDICTED: Homo sapiens solute carrier family 7 member 1 (SLC7A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC7A1 (6541)
Length:
7406
CDS:
380..2311

Additional Resources:

NCBI RefSeq record:
XM_017020713.2
NBCI Gene record:
SLC7A1 (6541)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042967 GCTGAGGATGGACTGCTATTT pLKO.1 1475 CDS 100% 13.200 10.560 N SLC7A1 n/a
2 TRCN0000290046 GCTGAGGATGGACTGCTATTT pLKO_005 1475 CDS 100% 13.200 10.560 N SLC7A1 n/a
3 TRCN0000042966 CTGGGCTAATTGTGAACATTT pLKO.1 1854 CDS 100% 13.200 9.240 N SLC7A1 n/a
4 TRCN0000290047 CTGGGCTAATTGTGAACATTT pLKO_005 1854 CDS 100% 13.200 9.240 N SLC7A1 n/a
5 TRCN0000042963 GCAGAGATGTTCTCTTTGAAA pLKO.1 1793 CDS 100% 5.625 3.938 N SLC7A1 n/a
6 TRCN0000290048 GCAGAGATGTTCTCTTTGAAA pLKO_005 1793 CDS 100% 5.625 3.938 N SLC7A1 n/a
7 TRCN0000042965 CCTACATCATCGGTACTTCAA pLKO.1 738 CDS 100% 4.950 3.465 N SLC7A1 n/a
8 TRCN0000290045 CCTACATCATCGGTACTTCAA pLKO_005 738 CDS 100% 4.950 3.465 N SLC7A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020713.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01546 pDONR223 100% 95.1% 86.6% None (many diffs) n/a
2 ccsbBroad304_01546 pLX_304 0% 95.1% 86.6% V5 (many diffs) n/a
3 TRCN0000469257 AAGTTTCTCATTACTCGCTGTCGC pLX_317 20.6% 95.1% 86.6% V5 (many diffs) n/a
Download CSV