Transcript: Human XM_017021026.1

PREDICTED: Homo sapiens solute carrier family 38 member 6 (SLC38A6), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC38A6 (145389)
Length:
1926
CDS:
584..1801

Additional Resources:

NCBI RefSeq record:
XM_017021026.1
NBCI Gene record:
SLC38A6 (145389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044803 GCATACTATTTGCTGTGCTTT pLKO.1 1425 CDS 100% 4.950 6.930 N SLC38A6 n/a
2 TRCN0000044807 CCATTCTCATGGATTCGCCAT pLKO.1 1511 CDS 100% 2.160 3.024 N SLC38A6 n/a
3 TRCN0000322860 ATGGACAAACACTACTAATAA pLKO_005 918 CDS 100% 15.000 10.500 N SLC38A6 n/a
4 TRCN0000322929 ACCTCAATATTGCCCATATAC pLKO_005 1211 CDS 100% 13.200 9.240 N SLC38A6 n/a
5 TRCN0000322859 GATCACTCTAGCACTCAATAT pLKO_005 1537 CDS 100% 13.200 9.240 N SLC38A6 n/a
6 TRCN0000044805 GCTACACAAGTAGTTTATCAT pLKO.1 996 CDS 100% 5.625 3.938 N SLC38A6 n/a
7 TRCN0000300978 GCTACACAAGTAGTTTATCAT pLKO_005 996 CDS 100% 5.625 3.938 N SLC38A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09618 pDONR223 100% 82.5% 79% None (many diffs) n/a
2 ccsbBroad304_09618 pLX_304 0% 82.5% 79% V5 (many diffs) n/a
3 TRCN0000477045 CCACTATGAATACCCCTTGTGGTA pLX_317 28.6% 82.5% 79% V5 (many diffs) n/a
Download CSV