Transcript: Human XM_017021079.1

PREDICTED: Homo sapiens estrogen receptor 2 (ESR2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ESR2 (2100)
Length:
4691
CDS:
1133..2725

Additional Resources:

NCBI RefSeq record:
XM_017021079.1
NBCI Gene record:
ESR2 (2100)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364068 TAGTGGTCCATCGCCAGTTAT pLKO_005 1398 CDS 100% 13.200 18.480 N ESR2 n/a
2 TRCN0000364067 AGCGATTACGCATCGGGATAT pLKO_005 1589 CDS 100% 10.800 15.120 N ESR2 n/a
3 TRCN0000003325 GCGAGTAACAAGGGCATGGAA pLKO.1 2534 CDS 100% 3.000 4.200 N ESR2 n/a
4 TRCN0000368381 CTGTTGGATGGAGGTGTTAAT pLKO_005 2131 CDS 100% 13.200 9.240 N ESR2 n/a
5 TRCN0000364069 CTTCAAGGTTTCGAGAGTTAA pLKO_005 2283 CDS 100% 13.200 9.240 N ESR2 n/a
6 TRCN0000378201 TGTAGACAGCCACCATGAATA pLKO_005 1240 CDS 100% 13.200 9.240 N ESR2 n/a
7 TRCN0000003328 GATGCTTTGGTTTGGGTGATT pLKO.1 2435 CDS 100% 4.950 3.465 N ESR2 n/a
8 TRCN0000003327 CCTTAATTCTCCTTCCTCCTA pLKO.1 1159 CDS 100% 2.640 1.584 N ESR2 n/a
9 TRCN0000003326 CTTTCTCCTTTAGTGGTCCAT pLKO.1 1388 CDS 100% 2.640 1.584 N ESR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021079.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489818 TATGATCCCCCGGGCGTATTTAGC pLX_317 24.1% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_10807 pDONR223 100% 60.6% 60% None (many diffs) n/a
3 ccsbBroad304_10807 pLX_304 0% 60.6% 60% V5 (many diffs) n/a
4 TRCN0000491774 TGGTTTATTTCGGACTCGCAGGAG pLX_317 47.6% 60.6% 60% V5 (many diffs) n/a
Download CSV